Page Comparison

...

1. Highlight
   red red
   P5 PCR primer/flowcell capture site:

   AATGATACGGCGACCACCGAAATGATACGGCGACCACCGAGATCT

2. Highlight
   yellow yellow
   BarcodeRead2:

   Optional. Example: GATCTTBD. This is called "BarcodeRead2 because it is read after template flip, when Read2 is read. The GSAF does not normally sequence this barcode - please request if you need it read.

3. Highlight
   green green
   Read1 primer site:

   Either the small RNA sequencing primer site: CAGGTTCAGAGTTCTACAGTCCGACGATC OR the standard TruSeq Read 1 primer site: ACACTCTTTCCCTACACGACGCTCTTCCGATCT. Which to chose? The TruSeq Read 1 primer site is complementary to the Read 2 primer site, so if you are designing amplicons do NOT use the TruSeq Read 1 primer site, use the small RNA sequencing primer site.
4. The insert to be sequenced

5. Highlight
   cyan cyan
   Read2 primer site:

   Then the Index read primer site: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC (note the initial A is from the dA tailing of the insert and is not included in the index primer or adaptor sequences; note also the reverse-complement of this is the Read 2 sequencing primer, but the Read 2 sequencing primer includes the T corresponding to the dA insert tail so sequencing starts with the insert)

6. Highlight
   blue blue
   BarcodeRead1:

   The index sequence (usually 6 bp)

7. Highlight
   purple purple
   P7 PCR primer/flowcell capture site:

   ATCTCGTATGCCGTCTTCTGCTTG

...