Page Comparison

...

Note: Highlighting provided prior to 6/2012 was incorrect. It showed the Index or Barcode Read 2 sequence as GATCT when in fact it the second index sequence is downstream of that site. We apologize for the error. See the section entitled, "Dual-index adaptor design..." below for corrected documentation.

Single index adaptor design on a standard Illumina HiSeq or MiSeq run

1. Highlight
   red red
   P5 PCR primer/flowcell capture site:

   AATGATACGGCGACCACCGAGATCTAATGATACGGCGACCACCGAGA

2. Highlight
   yellow yellow
   BarcodeRead2IndexRead2:

   Optional. Example: TBD. This is called "BarcodeRead2 because it is read after template flip, when Read2 is read. The GSAF does not normally sequence this barcode - please request if you need it read. Highlightgreengreen

   Read1 primer site:

   NONE.

3. Highlight
   green green
   Read1 primer site:

   Either the small RNA sequencing primer site: CAGGTTCAGAGTTCTACAGTCCGACGATC OR the standard TruSeq Read 1 primer site: ACACTCTTTCCCTACACGACGCTCTTCCGATCTTCTACACTCTTTCCCTACACGACGCTCTTCCGATCT. Which to chose? The TruSeq Read 1 primer site is complementary to the Read 2 primer site, so if you are designing amplicons do NOT use the TruSeq Read 1 primer site, use the small RNA sequencing primer site.
4. The insert to be sequenced

5. Highlight
   cyan cyan
   Read2 primer site:

   Then the Index read primer site: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC (note the initial A is from the dA tailing of the insert and is not included in the index primer or adaptor sequences; note also the reverse-complement of this is the Read 2 sequencing primer, but the Read 2 sequencing primer includes the T corresponding to the dA insert tail so sequencing starts with the insert)

6. Highlight
   blue blue
   BarcodeRead1IndexRead1:

   The index sequence (usually 6 bp) Highlightpurple- see many examples below in the Barcodes section. Within a lane, image analysis works best with as much base diversity as possible.

7. Highlight
   purple purple
   P7 PCR primer/flowcell capture site:

   ATCTCGTATGCCGTCTTCTGCTTG

Note: Highlighting provided prior to 6/2012 was incorrect. It showed the Barcode Read 2 sequence as GATCT when in fact it is downstream of that site. We apologize for the error.

Dual-index adaptor design on a standard Illumina PE HiSeq or MiSeq run

1. Highlight
   red red
   P5 PCR primer/flowcell capture site:

   AATGATACGGCGACCACCGAGATCTACAC

2. Highlight
   yellow yellow
   IndexRead2:

   Optional. Example: TAGATCGC. This is called "IndexRead2" because it is read after index read 1. The GSAF does not normally sequence this barcode - please request if you need it read. We have little guidance to offer on designs other than to re-use the same sequences as in the Index Read 1 site - base diversity is your friend.

3. Highlight
   green green
   Read1 primer site:

   The standard TruSeq Read 1 primer site: ACACTCTTTCCCTACACGACGCTCTTCCGATCT. We are not sure at this point whether the small RNA primer site is compatible with dual-indexes or not.
4. The remaining template elements are identical to the Single-index adaptor design above.

Barcodes (also known as Indexes)

...