Page Comparison

...

If this page isn't formatted well on your screen, try shrinking the side bar on the left side.

Canonical ILLUMINA library design as of

...

June 2012 (all 5'-3'), "TruSeq V3": NOTE all sequences shown are TOP STRAND 5' to 3'

Note: Highlighting provided prior to 6/2012 was incorrect. It showed the Barcode Read 2 sequence as GATCT when in fact it is downstream of that site. We apologize for the error.

1. Highlight
   red red
   P5 PCR primer/flowcell capture site:

   AATGATACGGCGACCACCGA

2. Highlight
   yellow yellow
   BarcodeRead2:

   Optional. Example: GATCT. This is called "BarcodeRead2 because it is read after template flip, when Read2 is read. The GSAF does not normally sequence this barcode - please request if you need it read.

3. Highlight
   green green
   Read1 primer site:

   Either the small RNA sequencing primer site: CAGGTTCAGAGTTCTACAGTCCGACGATC OR the standard TruSeq Read 1 primer site: ACACTCTTTCCCTACACGACGCTCTTCCGATCT. Which to chose? The TruSeq Read 1 primer site is complementary to the Read 2 primer site, so if you are designing amplicons do NOT use the TruSeq Read 1 primer site, use the small RNA sequencing primer site.
4. The insert to be sequenced

5. Highlight
   cyan cyan
   Read2 primer site:

   Then the Index read primer site: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC (note the initial A is from the dA tailing of the insert and is not included in the index primer or adaptor sequences; note also the reverse-complement of this is the Read 2 sequencing primer, but the Read 2 sequencing primer includes the T corresponding to the dA insert tail so sequencing starts with the insert)

6. Highlight
   blue blue
   BarcodeRead1:

   The index sequence (usually 6 bp)

7. Highlight
   purple purple
   P7 PCR primer/flowcell capture site:

   ATCTCGTATGCCGTCTTCTGCTTG

...