...
| Code Block |
|---|
| title | cutadapt command for R1 sequences |
|---|
|
/corral-repl/utexas/BioITeam/bin/cutadapt-1.3/bin/cutadapt -m 22 -Oa 10 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Sample1_R1.fastq
|
| Code Block |
|---|
| title | cutadapt command for R2 sequences |
|---|
|
/corral-repl/utexas/BioITeam/bin/cutadapt-1.3/bin/cutadapt -m 22 -O 10 -a TGATCGTCGGACTGTAGAACTCTGAACGTGTAGA Sample1_R1.fastq |
Notes:
- The -m 22 option says to discard any sequence that is smaller than 22 bases after trimming. This avoids problems trying to map very short, highly ambiguous sequences.the -O 10 option says not to trim 3' adapter sequences unless at least the first 10 bases of the adapter are ssen at the 3' end of the read. This prevents trimming short 3' sequences that just happen by chance to match the first few adapter sequence bases.
Paired end commands are a little more complicated:
| Code Block |
|---|
| title | cutadapt command for R2 sequences |
|---|
|
/corral-repl/utexas/BioITeam/bin/cutadapt-1.3/bin/cutadapt -a GATCGGAAGAGCACACGTCTGAACTCCA -m 22 --paired-output tmp.2.fastq -o tmp.1.fastq Sample1_R1.fastq Sample1_R2.fastq &
/corral-repl/utexas/BioITeam/bin/cutadapt-1.3/bin/cutadapt -a ATCGTCGGACTGTAGAACTCTGAACGTG -m 22 --paired-output trimmed.1.fastq -o trimmed.2.fastq tmp.2.fastq tmp.1.fastq &
rm tmp.1.fastq tmp.2.fastq
|
| Expand |
|---|
| title | The gory details on the *-a* adapter sequence argument |
|---|
|
Please refer to https://wikis.utexas.edu/display/GSAF/Illumina+-+all+flavors for Illumina library adapter layout. 
|
...