...
| Code Block |
|---|
| title | Get set up for the exercises |
|---|
|
cds
mkdir my_rnaseq_course #this is where you'll be doing all the course exercises
cd my_rnaseq_course
cp -r /corral-repl/utexas/BioITeam/rnaseq_course/fastqc_exercise .
cd fastqc_exercise
ls data |
Exercise: Examine the 2nd sequence in a FASTQ file
What is the 2nd sequence in the file SRR030257file Sample1_1R1.fastq?
| Expand |
|---|
|
Use the head command. |
| Expand |
|---|
|
| Code Block |
|---|
head data/SRR030257Sample1_1.fastq
|
Executing the command above reports that the 2nd sequence has ID = @SRR030257.2 HWI-EAS_4_PE-FC20GCB:6:1:407:767/1, and the sequence TAAGCCAGTCGCCATGGAATATCTGCTTTATTTAGCIf this doesn't work, check what directory you are in currently (pwd) and that you've provided the right path to the file. Tab is your friend! |
Exercise: Get the first 10 read IDs in the fastq file
| Expand |
|---|
|
grep for lines starting with @SRR @HWI since our reads start with that. For GSAF illumina read ids, they always start with @HWI |
| Expand |
|---|
|
| Code Block |
|---|
grep '^@SRR^@HWI' data/SRR030257Sample1_1R1.fastq |head |
|
Counting sequences
One of the first thing to check is that your fastq files are the same length, and that length is evenly divisible by four. The wc command (word count) using the -l switch to tell it to count lines, not words, is perfect for this:
| Code Block |
|---|
| title | Using wc -l to count lines |
|---|
|
wc -l data/SRR030257Sample1_1R1.fastq |
Exercise: Counting FASTQ file lines
...
| Expand |
|---|
|
The wc -l command says there are 15200720 16000000 lines. FASTQ files have 4 lines per sequence, so the file has 1516,200000,720000/4 or 34,800000,180 000 sequences. | Code Block |
|---|
grep '^@SRR^@HWI' data/SRR030257Sample1_1R1.fastq |wc -l
|
|
Lets move on to assessing the quality of this data...