...
Highlight |
---|
|
<P5 primer/capture site> |
Highlight |
---|
|
<BarcodeRead2><IndexRead2> |
Highlight |
---|
|
<Read1 primer site> |
<template - gDNA, RNA, amplicon, whatever>
Highlight |
---|
|
<Read2 primer site> |
Highlight |
---|
|
<BarcodeRead1><IndexRead1> |
Highlight |
---|
|
<P7 primer/capture site> |
Note: Highlighting provided prior to 6/2012 was incorrect. It showed the Index or Barcode Read 2 sequence as GATCT when in fact it the second index sequence is downstream of that site. We apologize for the error. See the section entitled, "Dual-index adaptor design..." below for corrected documentation.
Single index adaptor design on a standard Illumina HiSeq or MiSeq run
Highlight |
---|
|
P5 PCR primer/flowcell capture site: |
AATGATACGGCGACCACCGAGATCTAATGATACGGCGACCACCGAGA Highlight |
---|
|
BarcodeRead2IndexRead2: |
Optional. Example: TBD. This is called "BarcodeRead2 because it is read after template flip, when Read2 is read. The GSAF does not normally sequence this barcode - please request if you need it read. Highlight |
---|
green | green | Read1 primer site: |
NONE. Highlight |
---|
|
Read1 primer site: |
Either the small RNA sequencing primer site: CAGGTTCAGAGTTCTACAGTCCGACGATC OR the standard TruSeq Read 1 primer site: ACACTCTTTCCCTACACGACGCTCTTCCGATCTTCTACACTCTTTCCCTACACGACGCTCTTCCGATCT. Which to chose? The TruSeq Read 1 primer site is complementary to the Read 2 primer site, so if you are designing amplicons do NOT use the TruSeq Read 1 primer site, use the small RNA sequencing primer site.- The insert to be sequenced
Highlight |
---|
|
Read2 primer site: |
Then the Index read primer site: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC (note the initial A is from the dA tailing of the insert and is not included in the index primer or adaptor sequences; note also the reverse-complement of this is the Read 2 sequencing primer, but the Read 2 sequencing primer includes the T corresponding to the dA insert tail so sequencing starts with the insert) Highlight |
---|
|
BarcodeRead1IndexRead1: |
The index sequence (usually 6 bp) Highlight |
purple- see many examples below in the Barcodes section. Within a lane, image analysis works best with as much base diversity as possible. Highlight |
---|
|
P7 PCR primer/flowcell capture site: |
ATCTCGTATGCCGTCTTCTGCTTG
Highlight |
---|
|
<P5 primer/capture site> |
Highlight |
---|
|
<Read1 primer site> |
<template - gDNA, RNA, amplicon, whatever> Highlight |
---|
|
<Read2 primer site> |
Highlight |
---|
|
<P7 primer/capture site> |
Note: Highlighting provided prior to 6/2012 was incorrect. It showed the Barcode Read 2 sequence as GATCT when in fact it is downstream of that site. We apologize for the error.
Dual-index adaptor design on a standard Illumina PE HiSeq or MiSeq run
Highlight |
---|
|
P5 PCR primer/flowcell capture site: |
AATGATACGGCGACCACCGAGATCTACAC- Optional. Example: TAGATCGC. This is called "IndexRead2" because it is read after index read 1. The GSAF does not normally sequence this barcode - please request if you need it read. We have little guidance to offer on designs other than to re-use the same sequences as in the Index Read 1 site - base diversity is your friend.
Highlight |
---|
|
Read1 primer site: |
The standard TruSeq Read 1 primer site: ACACTCTTTCCCTACACGACGCTCTTCCGATCT. We are not sure at this point whether the small RNA primer site is compatible with dual-indexes or not.- The remaining template elements are identical to the Single-index adaptor design above.
Barcodes (also known as Indexes)
...