Versions Compared

Key

  • This line was added.
  • This line was removed.
  • Formatting was changed.

...

The GSAF uses the following names for the following barcodes. Note that these sequences are shown 5'-3' when the P5 sequence is on the rightleft. In other words, here is the first barcode shown in the context of the full 3'-end adaptor construct:
GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG

...