...
| Code Block |
|---|
| title | fastx_Clipper example |
|---|
|
fastx_clipper -a GATCGGAAGAGCACACGTCTGAACTCCA -i data/Sample1_R1.fastq -o Sample1_R1.cutadaptfastxclipped.fastq -l 20
|
More sophisticated tools like Trimgalore and cutadapt may be suitable, particularly with dealing with paired end data.
| Code Block |
|---|
|
module load cutadapt
#IF WE HAD PAIRED END DATA
cutadapt -a GATCGGAAGAGCACACGTCTGAACTCCA -o <R1_outputfile> -p <R2_outputfile> <inputR1file> <innputR2file><inputR2file>
|
| Expand |
|---|
| title | The gory details on the *-a* adapter sequence argument |
|---|
|
Please refer to https://utexas.atlassian.net/wiki/display/GSAF/Illumina+-+all+flavors for Illumina library adapter layout.
Below information holds true from old ligation-based RNA-libraries. In this case, the R1 adaptor is different from the R2 adaptor.
For current stranded RNA libraries (such as dUTP, used by GSAF), the R1 adaptor would be the same as the R2 adaptor.
Fastqc reports will give you an idea about which adaptor is present in your data. Further, it's always a good idea to grep -c <partofdaptorseq> <fastqfile> to make sure you have the right adaptor sequence before trimming. 
|
...