Before you start the alignment and analysis processes, it is useful to perform some initial quality checks on your raw data. Here we will assume you have data from GSAF's Illumina HiSeq sequencer.
When following along here, please start an idev session (within another ssh session) for running any example commands:
Leave out -r rna-seq-class-0609 option if you are not part of the reservation or if it's not working |
GSAF gives you paired end sequencing data in two matching fastq format files, contining reads for each end sequenced -- for example Sample_ABC_L005_R1.cat.fastq and Sample_ABC_L005_R2.cat.fastq. Each read end sequenced is representd by a 4-line entry in the fastq file.
A 4-line fastq file entry looks like this:
@HWI-ST1097:104:D13TNACXX:4:1101:1715:2142 1:N:0:CGATGT GCGTTGGTGGCATAGTGGTGAGCATAGCTGCCTTCCAAGCAGTTATGGGAG + =<@BDDD=A;+2C9F<CB?;CGGA<<ACEE*1?C:D>DE=FC*0BAG?DB6 |
See the Wikipedia FASTQ format page for more information.
Get your data
To try out exercises, we've provided some sample data on lonestar6.
So, go get it!
cds cd my_rnaseq_course cd day_1_partA/fastqc_exercise ls ls data |
Exercise: Examine the 2nd sequence in a FASTQ file
What is the 2nd sequence in the file Sample1_R1.fastq?
Use the head command. |
If this doesn't work, check what directory you are in currently (pwd) and that you've provided the right path to the file. Tab is your friend! |
Exercise: Get the first 10 read IDs in the fastq file
grep for lines starting with @HWI since our reads start with that. For one of GSAF illumina machine names starts with HWI, so if your data was generated on that machine, the reads should start with @HWI |
|
Counting sequences
One of the first thing to check is that your fastq files are the same length, and that length is evenly divisible by four. The wc command (word count) using the -l switch to tell it to count lines, not words, is perfect for this:
wc -l data/Sample1_R1.fastq |
Exercise: Counting FASTQ file lines
How many sequences are in the FASTQ file above?
The wc -l command says there are 16000000 lines. FASTQ files have 4 lines per sequence, so the file has 16,000,000/4 or 4,000,000 sequences.
|
Lets move on to assessing the quality of this data...