Reservations
Use our summer school reservation (core-ngs-class-0605) for today when submitting batch jobs to get higher priority on the ls6 normal queue.
# Request a 180 minute interactive node on the normal queue using our reservation idev -m 120 -N 1 -A OTH21164 -r core-ngs-class-0605 # Request a 120 minute idev node on the development queue idev -m 120 -N 1 -A OTH21164 -p development
# Using our reservation sbatch --reseservation=core-ngs-class-0605 <batch_file>.slurm
Note that today's reservation name (core-ngs-class-0605) is different from the TACC allocation/project for this class, which is OTH21164.
Overview
After raw sequence files are generated (in FASTQ format), quality-checked, and preprocessed in some way, the next step in many NGS pipelines is mapping to a reference genome.
For individual sequences it is common to use a tool like BLAST to identify genes or species of origin. However a normal NGS dataset will have tens to hundreds of millions of sequences, which BLAST and similar tools are not designed to handle. Thus a large set of computational tools have been developed to quickly align each read to its best location (if any) in a reference.
Even though many mapping tools exist, a few individual programs have a dominant "market share" of the NGS world. In this section, we will primarily focus on two of the most versatile general-purpose ones: BWA and Bowtie2 (the latter being part of the Tuxedo suite which includes the transcriptome-aware RNA-seq aligner Tophat2 as well as other downstream quantification tools).
Stage the alignment data
First connect to ls6.tacc.utexas.edu and start an idev session. This should be second nature by now ![]()
idev -m 180 -N 1 -A OTH21164 -r core-ngs-class-0605
Then stage the sample datasets and references we will use.
# Copy the FASTA files for building references mkdir -p $SCRATCH/core_ngs/references/fasta cp $CORENGS/references/fasta/*.fa $SCRATCH/core_ngs/references/fasta/ # Copy the FASTQ files that will be used for alignment mkdir -p $SCRATCH/core_ngs/alignment/fastq cp $CORENGS/alignment/*fastq.gz $SCRATCH/core_ngs/alignment/fastq/ cd $SCRATCH/core_ngs/alignment/fastq
These are descriptions of the FASTQ files we copied:
| File Name | Description | Sample |
|---|---|---|
| Sample_Yeast_L005_R1.cat.fastq.gz | Paired-end Illumina, First of pair, FASTQ | Yeast ChIP-seq |
| Sample_Yeast_L005_R2.cat.fastq.gz | Paired-end Illumina, Second of pair, FASTQ | Yeast ChIP-seq |
| human_rnaseq.fastq.gz | Paired-end Illumina, First of pair only, FASTQ | Human RNA-seq |
| human_mirnaseq.fastq.gz | Single-end Illumina, FASTQ | Human microRNA-seq |
| cholera_rnaseq.fastq.gz | Single-end Illumina, FASTQ | V. cholerae RNA-seq |
Reference Genomes
Before we get to alignment, we need a reference to align to. This is usually an organism's genome, but can also be any set of names sequences, such as a transcriptome or other set of genes.
Here are the four reference genomes we will be using today, with some information about them. These are not necessarily the most recent versions of these references (e.g. the newest human reference genome is hg38 and the most recent miRBase version is v21. (See here for information about many more genomes.)
| Reference | Species | Base Length | Contig Number | Source | Download |
|---|---|---|---|---|---|
| hg19 | Human | 3.1 Gbp | 25 (really 93) | UCSC | UCSC GoldenPath |
| sacCer3 | Yeast | 12.2 Mbp | 17 | UCSC | UCSC GoldenPath |
| mirbase v20 | Human subset | 160 Kbp | 1908 | miRBase | miRBase Downloads |
| vibCho (ASM836960v1) | Vibrio cholerae | ~4 Mbp | 3 | GenBank | GenBank Downloads |
Searching genomes is computationally hard work and takes a long time if done on linear genomic sequence. So aligners require that references first be indexed to accelerate lookup. The aligners we are using each require a different index, but use the same method (the Burrows-Wheeler Transform) to get the job done.
Building a reference index involves taking a FASTA file as input, with each contig (contiguous string of bases, e.g. a chromosome) as a separate FASTA entry, and producing an aligner-specific set of files as output. Those output index files are then used to perform the sequence alignment, and alignments are reported using coordinates referencing names and offset positions based on the original FASTA file contig entries.
We can quickly index the references for the yeast genome, the human miRNAs, and the V. cholerae genome, because they are all small, so we'll build each index from the appropriate FASTA files right before we use them.
hg19 is way too big for us to index here so we will use an existing set of BWA hg19 index files located at:
/work/projects/BioITeam/ref_genome/bwa/bwtsw/hg19
The BioITeam maintains a set of reference indexes for many common organisms and aligners. They can be found in aligner-specific sub-directories of the /work/projects/BioITeam/ref_genome area. E.g.:
/work/projects/BioITeam/ref_genome/ bowtie2/ bwa/ hisat2/ kallisto/ star/ tophat/
Exploring FASTA with grep
It is often useful to know what chromosomes/contigs are in a FASTA file before you start an alignment so that you're familiar with the contig naming convention – and to verify that it's the one you expect. For example, chromosome 1 is specified differently in different references and organisms: chr1 (USCS human), chrI (UCSC yeast), or just 1 (Ensembl human GRCh37).
A FASTA file consists of a number of contig name entries, each one starting with a right carat ( > ) character, followed by many lines of base characters. E.g.:
>chrI CCACACCACACCCACACACCCACACACCACACCACACACCACACCACACC CACACACACACATCCTAACACTACCCTAACACAGCCCTAATCTAACCCTG GCCAACCTGTCTCTCAACTTACCCTCCATTACCCTGCCTCCACTCGTTAC CCTGTCCCATTCAACCATACCACTCCGAACCACCATCCATCCCTCTACTT
How do we dig out just the lines that have the contig names and ignore all the sequences? Well, the contig name lines all follow the pattern above, and since the > character is not a valid base, it will never appear on a sequence line.
We've discovered a pattern (also known as a regular expression) to use in searching, and the command line tool that does regular expression matching is grep (general regular expression parser). (Read more about grep and regular expressions)
Regular expressions are so powerful that nearly every modern computer language includes a "regex" module of some sort. There are many online tutorials for regular expressions, and several slightly different "flavors" of them. But the most common is the Perl style (http://perldoc.perl.org/perlretut.html), which was one of the fist and still the most powerful (there's a reason Perl was used extensively when assembling the human genome). We're only going to use simple regular expressions here, but learning more about them will pay handsome dividends for you in the future.
First stage the FASTA files we'll need:
cds mkdir -p core_ngs/references/fasta cd core_ngs/references/fasta cp $CORENGS/references/fasta/*.fa .
Here's how to execute grep to list contig names in a FASTA file.
cd $SCRATCH/core_ngs/references/fasta grep -P '^>' sacCer3.fa | more
Notes:
- The -P option tells grep to Perl-style regular expression patterns.
- This makes including special characters like Tab ( \t ), carriage return ( \r ) or linefeed ( \n ) much easier that the default POSIX paterns.
- While it is not required here, it generally doesn't hurt to include this option.
'^>' is the regular expression describing the pattern we're looking for (described below)
- sacCer3.fa is the FASTA file to search.
- lines with text that match our pattern will be written to standard output
- non matching lines will be omitted
- We pipe to more just in case there are a lot of contig names.
Now down to the nuts and bolts of the pattern: '^>'
First, the single quotes around the pattern – this tells the bash shell to pass the exact string contents to grep.
As we have seen, during command line parsing and evaluation the shell will often look for special metacharacters on the command line that mean something to it (for example, the $ in front of an environment variable name, like in $SCRATCH). Well, regular expressions treat the $ specially too – but in a completely different way! Those single quotes tell the shell "don't look inside here for special characters – treat this as a literal string and pass it to the program". The shell will obey, will strip the single quotes off the string, and will pass the actual pattern, ^>, to the grep program. (Read more about Literal characters and metacharacters and Quoting in the shell)
So what does ^> mean to grep? We know that contig name lines always start with a > character, so > is a literal for grep to use in its pattern match.
We might be able to get away with just using this literal alone as our regex, specifying '>' as the command line pattern argument. But for grep, the more specific the pattern, the better. So we constrain where the > can appear on the line. The special carat ( ^ ) metacharacter represents "beginning of line". So ^> means "beginning of a line followed by a > character".
Exercise: How many lines does the sacCer3 reference have, and how many contigs are there?
Aligner overview
There are many aligners available, but we will concentrate on two of the most popular general-purpose ones: bwa and bowtie2. The table below outlines the available protocols for them.
| alignment type | aligner options | pro's | con's |
|---|---|---|---|
| global with bwa | single end reads:
paired end reads:
|
|
|
| global with bowtie2 | bowtie2 |
|
|
| local with bwa | bwa mem |
|
|
| local with bowtie2 | bowtie2 --local |
|
|
Exercise #1: BWA global alignment – Yeast ChIP-seq
Overview ChIP-seq alignment workflow with BWA
We will perform a global alignment of the paired-end Yeast ChIP-seq sequences using bwa. This workflow has the following steps:
- Trim the FASTQ sequences down to 50 with fastx_clipper
- this removes most of any 5' adapter contamination without the fuss of specific adapter trimming w/cutadapt
- Prepare the sacCer3 reference index for bwa using bwa index
- this is done once, and re-used for later alignments
- Perform a global bwa alignment on the R1 reads (bwa aln) producing a BWA-specific binary .sai intermediate file
- Perform a global bwa alignment on the R2 reads (bwa aln) producing a BWA-specific binary .sai intermediate file
- Perform pairing of the separately aligned reads and report the alignments in SAM format using bwa sampe
- Convert the SAM file to a BAM file (samtools view)
- Sort the BAM file by genomic location (samtools sort)
- Index the BAM file (samtools index)
- Gather simple alignment statistics (samtools flagstat and samtools idxstats)
We're going to skip the trimming step and perform steps 2 - 5 now, leaving samtools for a later exercise since steps 6 - 10 are common to nearly all post-alignment workflows.
Introducing BWA
Like other tools you've worked with so far, you first need to load bwa. Do that now, and then enter bwa with no arguments to view the top-level help page (many NGS tools will provide some help when called with no arguments). bwa is available as a BioContainers. module.
Make sure you're in an idev session
idev -m 180 -N 1 -A OTH21164 -r core-ngs-class-0605 # or idev -m 120 -N 1 -A OTH21164 -p development
module load biocontainers # takes a while module load bwa bwa
Program: bwa (alignment via Burrows-Wheeler transformation)
Version: 0.7.17-r1188
Contact: Heng Li <lh3@sanger.ac.uk>
Usage: bwa <command> [options]
Command: index index sequences in the FASTA format
mem BWA-MEM algorithm
fastmap identify super-maximal exact matches
pemerge merge overlapping paired ends (EXPERIMENTAL)
aln gapped/ungapped alignment
samse generate alignment (single ended)
sampe generate alignment (paired ended)
bwasw BWA-SW for long queries
shm manage indices in shared memory
fa2pac convert FASTA to PAC format
pac2bwt generate BWT from PAC
pac2bwtgen alternative algorithm for generating BWT
bwtupdate update .bwt to the new format
bwt2sa generate SA from BWT and Occ
Note: To use BWA, you need to first index the genome with `bwa index'.
There are three alignment algorithms in BWA: `mem', `bwasw', and
`aln/samse/sampe'. If you are not sure which to use, try `bwa mem'
first. Please `man ./bwa.1' for the manual.
As you can see, bwa include many sub-commands that perform the tasks we are interested in.
Building the BWA sacCer3 index
We will index the genome with the bwa index command. Type bwa index with no arguments to see usage for this sub-command.
Usage: bwa index [options] <in.fasta>
Options: -a STR BWT construction algorithm: bwtsw, is or rb2 [auto]
-p STR prefix of the index [same as fasta name]
-b INT block size for the bwtsw algorithm (effective with -a bwtsw) [10000000]
-6 index files named as <in.fasta>.64.* instead of <in.fasta>.*
Warning: `-a bwtsw' does not work for short genomes, while `-a is' and
`-a div' do not work not for long genomes.
Based on the usage description, we only need to specify two things:
- The name of the FASTA file
- Whether to use the bwtsw or is algorithm for indexing
Since sacCer3 is relative large (~12 Mbp) we will specify bwtsw as the indexing option (as indicated by the "Warning" message), and the name of the FASTA file is sacCer3.fa.
The output of this command is a group of files that are all required together as the index. So, within our references directory, we will create another directory called references/bwa/sacCer3 and build the index there. To remind ourselves which FASTA was used to build the index, we create a symbolic link to our references/fasta/sacCer3.fa file (note the use of the ../.. relative path syntax).
mkdir -p $SCRATCH/core_ngs/references/bwa/sacCer3 cd $SCRATCH/core_ngs/references/bwa/sacCer3 # Create a symbolic link to the sacCer3 FASTA file # so it can be accessed directly from this directory ln -sf ../../fasta/sacCer3.fa ls -l
Now execute the bwa index command.
bwa index -a bwtsw sacCer3.fa
Since the yeast genome is not large when compared to human, this should not take long to execute (otherwise we would do it as a batch job). When it is complete you should see a set of index files like this:
sacCer3.fa sacCer3.fa.amb sacCer3.fa.ann sacCer3.fa.bwt sacCer3.fa.pac sacCer3.fa.sa
Performing the bwa alignment
Now, we're ready to execute the actual alignment, with the goal of initially producing a SAM file from the input FASTQ files and reference. First prepare a directory for this exercise and link the sacCer3 reference directories there (this will make our commands more readable).
mkdir -p $SCRATCH/core_ngs/alignment/yeast_bwa cd $SCRATCH/core_ngs/alignment/yeast_bwa # Create symbolic links to the fastq and sacCer3 reference directories # so we can access them directly from this alignment directory ln -sf ../fastq ln -sf ../../references/bwa/sacCer3 ls -l
As our workflow indicated, we first use bwa aln on the R1 and R2 FASTQs, producing a BWA-specific .sai intermediate binary files.
Exercise: What does bwa aln needs in the way of arguments? And where does it write its binary output?
There are lots of options, but here is a summary of the most important ones.
| Option | Effect |
|---|---|
| -l | Specifies the length of the seed (default = 32) |
| -k | Specifies the number of mismatches allowable in the seed of each alignment (default = 2) |
| -n | Specifies the number of mismatches (or fraction of bases in a given alignment that can be mismatches) in the entire alignment (including the seed) (default = 0.04) |
| -t | Specifies the number of threads |
Other options control the details of how much a mismatch or gap is penalized, limits on the number of acceptable hits per read, and so on. Much more information can be found on the BWA manual page. For a basic alignment like this, we can just go with the default alignment parameters.
Since bwa writes its (binary) output to standard output by default, so we need to redirect that to a .sai file.
For simplicity, we will just execute these commands directly, one at a time. Each command should only take few minutes and you will see bwa's progress messages in your terminal.
# If not already loaded: module load biocontainers module load bwa cd $SCRATCH/core_ngs/alignment/yeast_bwa bwa aln sacCer3/sacCer3.fa fastq/Sample_Yeast_L005_R1.cat.fastq.gz > yeast_pe_R1.sai bwa aln sacCer3/sacCer3.fa fastq/Sample_Yeast_L005_R2.cat.fastq.gz > yeast_pe_R2.sai
When all is done you should have two .sai files: yeast_pe_R1.sai and yeast_pe_R2.sai.
Make sure your output files are not empty
Double check that output was written by doing ls -lh and making sure the file sizes listed are not 0.
When redirection ( > ) to a file is used, the target file is created whether or not the command produced any output!
Exercise: How long did it take to align the R2 file?
Since you have your own private compute node, you can use all its resources. It has 128 cores, so re-run the R2 alignment asking for 60 execution threads.
bwa aln -t 60 sacCer3/sacCer3.fa \ fastq/Sample_Yeast_L005_R2.cat.fastq.gz > yeast_pe_R2.sai
Exercise: How much of a speedup did you seen when aligning the R2 file with 60 threads?
Exercise: How would you capture the diagnostic output from bwa aln?
Next we use the bwa sampe command to pair the reads and output SAM format data. Just type bwa sampe 2>&1 | more to see its usage.
For this command you provide the same reference index prefix as for bwa aln, along with the two .sai files and the two original FASTQ files. Also, bwa writes its output to standard output by default, so redirect that to a .sam file.
Here is the command line statement you need. Just execute it on the command line.
cd $SCRATCH/core_ngs/alignment/yeast_bwa bwa sampe sacCer3/sacCer3.fa yeast_pe_R1.sai yeast_pe_R2.sai \ fastq/Sample_Yeast_L005_R1.cat.fastq.gz \ fastq/Sample_Yeast_L005_R2.cat.fastq.gz > yeast_pe.sam
You should now have a SAM file (yeast_pe.sam) that contains the alignments.
Exercises:
- How many lines does the SAM file have?
- How does this compare to the number of input sequences (R1+R2)?
yeast_pe.sam is just a text file, so take a look with head, more, less, tail, or whatever you feel like. Later you'll learn additional ways to analyze the data with samtools once you create a BAM file.
Exercise: What kind of information is in the first lines of the SAM file?
Exercise: How many alignment records (not header records) are in the SAM file?
Exercises:
- Does the SAM file contain both mapped and un-mapped reads?
- What is the order of the alignment records in this SAM file?
Using cut to isolate fields
Recall the format of a SAM alignment record:
Suppose you wanted to look only at field 3 (contig name) values in the SAM file. You can do this with the handy cut command. Below is a simple example where you're asking cut to display the 3rd column value for the last 10 alignment records.
tail yeast_pe.sam | cut -f 3
By default cut assumes the field delimiter is Tab, which is the delimiter used in the majority of NGS file formats. You can specify a different delimiter with the -d option.
You can also specify a range of fields, and mix adjacent and non-adjacent fields. This displays fields 2 through 6 and field 9:
tail -20 yeast_pe.sam | cut -f 2-6,9
You may have noticed that some alignment records contain contig names (e.g. chrV) in field 3 while others contain an asterisk ( * ). The * means the record didn't map. We're going to use this heuristic along with cut to see about how many records represent aligned sequences. (Note this is not the strictly correct method of finding unmapped reads because not all unmapped reads have an asterisk in field 3. Later you'll see how to properly distinguish between mapped and unmapped reads using samtools.)
First we need to make sure that we don't look at fields in the SAM header lines. We're going to end up with a series of pipe operations, and the best way to make sure you're on track is to enter them one at a time piping to head:
# the ^@ pattern matches lines starting with @ (only header lines), # and -v says output lines that don't match grep -v -P '^@' yeast_pe.sam | head
Ok, it looks like we're seeing only alignment records. Now let's pull out only field 3 using cut:
grep -v -P '^@' yeast_pairedend.sam | cut -f 3 | head
Cool, we're only seeing the contig name info now. Next we use grep again, piping it our contig info and using the -v (invert) switch to say print lines that don't match the pattern:
grep -v -P '^@' yeast_pe.sam | cut -f 3 | grep -v '*' | head
Perfect! We're only seeing real contig names that (usually) represent aligned reads. Let's count them by piping to wc -l (and omitting omit head of course – we want to count everything).
grep -v -P '^@' yeast_pe.sam | cut -f 3 | grep -v '*' | wc -l # or grep -v -P '^@' yeast_pe.sam | cut -f 3 | grep -c -v '*'
Read more at Some Linux commands: Advanced commands
Exercise: About how many records represent aligned sequences? What alignment rate does this represent?
Exercise: What might we try in order to improve the alignment rate?
Exercise #2: Basic SAMtools Utilities
The SAMtools program is a commonly used set of tools that allow a user to manipulate SAM/BAM files in many different ways, ranging from simple tasks (like SAM/BAM format conversion) to more complex functions (like sorting, indexing and statistics gathering). It is available in the TACC module system (as well as in BioContainers). Load that module and see what samtools has to offer:
# If not already loaded module load biocontainers # takes a while module load samtools samtools 2>&1 | more
Program: samtools (Tools for alignments in the SAM format) Version: 1.20 (using htslib 1.20) Usage: samtools <command> [options] Commands: -- Indexing dict create a sequence dictionary file faidx index/extract FASTA fqidx index/extract FASTQ index index alignment -- Editing calmd recalculate MD/NM tags and '=' bases fixmate fix mate information reheader replace BAM header targetcut cut fosmid regions (for fosmid pool only) addreplacerg adds or replaces RG tags markdup mark duplicates ampliconclip clip oligos from the end of reads -- File operations collate shuffle and group alignments by name cat concatenate BAMs consensus produce a consensus Pileup/FASTA/FASTQ merge merge sorted alignments mpileup multi-way pileup sort sort alignment file split splits a file by read group quickcheck quickly check if SAM/BAM/CRAM file appears intact fastq converts a BAM to a FASTQ fasta converts a BAM to a FASTA import Converts FASTA or FASTQ files to SAM/BAM/CRAM reference Generates a reference from aligned data reset Reverts aligner changes in reads -- Statistics bedcov read depth per BED region coverage alignment depth and percent coverage depth compute the depth flagstat simple stats idxstats BAM index stats cram-size list CRAM Content-ID and Data-Series sizes phase phase heterozygotes stats generate stats (former bamcheck) ampliconstats generate amplicon specific stats -- Viewing flags explain BAM flags head header viewer tview text alignment viewer view SAM<->BAM<->CRAM conversion depad convert padded BAM to unpadded BAM samples list the samples in a set of SAM/BAM/CRAM files -- Misc help [cmd] display this help message or help for [cmd] version detailed version information
In this exercise, we will explore five utilities provided by samtools: view, sort, index, flagstat, and idxstats. Each of these is executed in one line for a given SAM/BAM file. In the SAMtools/BEDtools sections tomorrow we will explore samtools capabilities more in depth.
Know your samtools version!
There are two main "eras" of SAMtools development:
- "original" samtools, controlled by author Heng Li
- v 0.1.19 is the last stable version
- "modern" samtools, controlled by a group of programmers
- v 1.0, 1.1, 1.2 – avoid these (very buggy!)
- v 1.3+ – finally stable!
Unfortunately, some functions with the same name in both version eras have different options and arguments! So be sure you know which version you're using. (The samtools version is usually reported at the top of its usage listing).
TACC BioContainers also offers the original samtools version: samtools/ctr-0.1.19--3.
samtools view
The samtools view utility provides a way of converting between SAM (text) and BAM (binary, compressed) format. It also provides many, many other functions which we will discuss lster. To get a preview, execute samtools view 2>&1 | more. You should see:
Usage: samtools view [options] <in.bam>|<in.sam>|<in.cram> [region ...]
Options:
-b output BAM
-C output CRAM (requires -T)
-1 use fast BAM compression (implies -b)
-u uncompressed BAM output (implies -b)
-h include header in SAM output
-H print SAM header only (no alignments)
-c print only the count of matching records
-o FILE output file name [stdout]
-U FILE output reads not selected by filters to FILE [null]
-t FILE FILE listing reference names and lengths (see long help) [null]
-X include customized index file
-L FILE only include reads overlapping this BED FILE [null]
-r STR only include reads in read group STR [null]
-R FILE only include reads with read group listed in FILE [null]
-d STR:STR
only include reads with tag STR and associated value STR [null]
-D STR:FILE
only include reads with tag STR and associated values listed in
FILE [null]
-q INT only include reads with mapping quality >= INT [0]
-l STR only include reads in library STR [null]
-m INT only include reads with number of CIGAR operations consuming
query sequence >= INT [0]
-f INT only include reads with all of the FLAGs in INT present [0]
-F INT only include reads with none of the FLAGS in INT present [0]
-G INT only EXCLUDE reads with all of the FLAGs in INT present [0]
-s FLOAT subsample reads (given INT.FRAC option value, 0.FRAC is the
fraction of templates/read pairs to keep; INT part sets seed)
-M use the multi-region iterator (increases the speed, removes
duplicates and outputs the reads as they are ordered in the file)
-x STR read tag to strip (repeatable) [null]
-B collapse the backward CIGAR operation
-? print long help, including note about region specification
-S ignored (input format is auto-detected)
--no-PG do not add a PG line
--input-fmt-option OPT[=VAL]
Specify a single input file format option in the form
of OPTION or OPTION=VALUE
-O, --output-fmt FORMAT[,OPT[=VAL]]...
Specify output format (SAM, BAM, CRAM)
--output-fmt-option OPT[=VAL]
Specify a single output file format option in the form
of OPTION or OPTION=VALUE
-T, --reference FILE
Reference sequence FASTA FILE [null]
-@, --threads INT
Number of additional threads to use [0]
--write-index
Automatically index the output files [off]
--verbosity INT
Set level of verbosity
That is a lot to process! For now, we just want to read in a SAM file and output a BAM file. The input format is auto-detected, so we don't need to specify it (although you do in v0.1.19). We just need to tell the tool to output the file in BAM format, and to include the header records.
cd $SCRATCH/core_ngs/alignment/yeast_bwa samtools view -b yeast_pe.sam > yeast_pe.bam
- the -b option tells the tool to output BAM format
The BAM file is a binary file, not a text file, so how do you look at its contents now? Just use samtools view without the -b option. Remember to pipe output to a pager!
samtools view yeast_pe.bam | more
Notice that this does not show us the header record we saw at the start of the SAM file.
Exercises:
- What samtools view option will include the header records in its output?
- Which option would show only the header records?
samtools sort
Looking at some of the alignment record information:
samtools view yeast_pe.bam | cut -f 1-4 | more
You will notice that read names appear in adjacent pairs (for the R1 and R2), in the same order they appeared in the original FASTQ file. This means the records are in name order and, searching through the file is very inefficient. samtools sort re-orders entries in the SAM file either by locus (contig name + coordinate position) or by read name.
If you execute samtools sort 2>&1 | more, you see its help page:
Usage: samtools sort [options...] [in.bam]
Options:
-l INT Set compression level, from 0 (uncompressed) to 9 (best)
-u Output uncompressed data (equivalent to -l 0)
-m INT Set maximum memory per thread; suffix K/M/G recognized [768M]
-M Use minimiser for clustering unaligned/unplaced reads
-R Do not use reverse strand (only compatible with -M)
-K INT Kmer size to use for minimiser [20]
-I FILE Order minimisers by their position in FILE FASTA
-w INT Window size for minimiser indexing via -I ref.fa [100]
-H Squash homopolymers when computing minimiser
-n Sort by read name (natural): cannot be used with samtools index
-N Sort by read name (ASCII): cannot be used with samtools index
-t TAG Sort by value of TAG. Uses position as secondary index (or read name if -n is set)
-o FILE Write final output to FILE rather than standard output
-T PREFIX Write temporary files to PREFIX.nnnn.bam
--no-PG
Do not add a PG line
--template-coordinate
Sort by template-coordinate
--input-fmt-option OPT[=VAL]
Specify a single input file format option in the form
of OPTION or OPTION=VALUE
-O, --output-fmt FORMAT[,OPT[=VAL]]...
Specify output format (SAM, BAM, CRAM)
--output-fmt-option OPT[=VAL]
Specify a single output file format option in the form
of OPTION or OPTION=VALUE
--reference FILE
Reference sequence FASTA FILE [null]
-@, --threads INT
Number of additional threads to use [0]
--write-index
Automatically index the output files [off]
--verbosity INT
Set level of verbosity
In most cases you will be sorting a BAM file from name order to locus order. You can use either -o or redirection with > to control the output.
To sort the paired-end yeast BAM file by position, and get a BAM file named yeast_pe.sort.bam as output, execute the following command:
cd $SCRATCH/core_ngs/alignment/yeast_bwa samtools sort -O bam -T yeast_pe.tmp yeast_pe.bam > yeast_pe.sort.bam
- The -O options says the Output format should be BAM
- The -T options gives a prefix for Temporary files produced during sorting
- sorting large BAMs will produce many temporary files during processing
- make sure the temporary file prefix is different from the input BAM file prefix!
- By default sort writes its output to standard output, so we use > to redirect to a file named yeast_pe.sort.bam
Exercise: Compare the file sizes of the yeast_pe .sam, .bam, and .sort.bam files and explain why they are different.
samtools index
Many tools (like IGV, the Integrative Genomics Viewer) only need to use portions of a BAM file at a given point in time. For example, if you are viewing alignments that are within a particular gene, alignment records on other chromosomes do not need to be loaded. In order to speed up access, BAM files are indexed, producing BAI files which allow fast random access. This is especially important when you have many alignment records.
The utility samtools index creates an index that has the same name as the input BAM file, with suffix .bai appended. Here's the samtools index usage:
Usage: samtools index -M [-bc] [-m INT] <in1.bam> <in2.bam>... or: samtools index [-bc] [-m INT] <in.bam> [out.index] Options: -b, --bai Generate BAI-format index for BAM files [default] -c, --csi Generate CSI-format index for BAM files -m, --min-shift INT Set minimum interval size for CSI indices to 2^INT [14] -M Interpret all filename arguments as files to be indexed -o, --output FILE Write index to FILE [alternative to <out.index> in args] -@, --threads INT Sets the number of threads [none]
The syntax here is way, way easier. We want a BAI-format index which is the default. (CSI-format is used with extremely long contigs, which don't apply here - the most common use case is for polyploid plant genomes).
So all we have to provide is the sorted BAM:
samtools index yeast_pe.sort.bam
This will produce a file named yeast_pe.bam.bai.
Most of the time when an index is required, it will be automatically located as long as it is in the same directory as its BAM file and shares the same name up until the .bai extension.
Exercise: Compare the sizes of the sorted BAM file and its BAI index.
samtools flagstat
Since the BAM file contains records for both mapped and unmapped reads, just counting records doesn't provide information about the mapping rate of our alignment. The samtools flagstat tool provides a simple analysis of mapping rate based on the the SAM flag fields.
Here's how to run samtools flagstat and both see the output in the terminal and save it in a file – the samtools flagstat standard output is piped to tee, which both writes it to the specified file and sends it to its standard output:
samtools flagstat yeast_pe.sort.bam | tee yeast_pe.flagstat.txt
You should see something like this:
1184360 + 0 in total (QC-passed reads + QC-failed reads) 1184360 + 0 primary 0 + 0 secondary 0 + 0 supplementary 0 + 0 duplicates 0 + 0 primary duplicates 547664 + 0 mapped (46.24% : N/A) 547664 + 0 primary mapped (46.24% : N/A) 1184360 + 0 paired in sequencing 592180 + 0 read1 592180 + 0 read2 473114 + 0 properly paired (39.95% : N/A) 482360 + 0 with itself and mate mapped 65304 + 0 singletons (5.51% : N/A) 534 + 0 with mate mapped to a different chr 227 + 0 with mate mapped to a different chr (mapQ>=5)
Ignore the "+ 0" addition to each line - that is a carry-over convention for counting "QA-failed reads" that is no longer relevant.
The most important statistic is the mapping rate – here 46%, which is low. But this readout also allows you to verify that some common expectations (e.g. that about the same number of R1 and R2 reads aligned, and that most mapped reads are proper pairs) are met.
Exercise: What proportion of mapped reads were properly paired?
samtools idxstats
More information about the alignment is provided by the samtools idxstats report, which shows how many reads aligned to each contig in your reference.
Note that samtools idxstats must be run on a sorted, indexed BAM file.
samtools idxstats yeast_pe.sort.bam | tee yeast_pe.idxstats.txt
Here we use the tee command which reports its output to standard output before also writing it to the specified file.
chrI 230218 8820 1640 chrII 813184 36616 4026 chrIII 316620 13973 1530 chrIV 1531933 72675 8039 chrV 576874 27466 2806 chrVI 270161 10866 1222 chrVII 1090940 50893 5786 chrVIII 562643 24672 3273 chrIX 439888 16246 1739 chrX 745751 31748 3611 chrXI 666816 28017 2776 chrXII 1078177 54783 10124 chrXIII 924431 40921 4556 chrXIV 784333 33070 3703 chrXV 1091291 48714 5150 chrXVI 948066 44916 5032 chrM 85779 3268 291 * 0 0 571392
The output has four tab-delimited columns:
- contig name
- contig length
- number of mapped reads
- number of unmapped reads
The reason that the "unmapped reads" field for named chromosomes is not zero is that the aligner may initially assign a potential mapping (contig name and start coordinate) to a read, but then mark it later as unampped if it does meet various quality thresholds.
If you're mapping to a non-genomic reference such as miRBase miRNAs or another set of genes (a transcriptome), samtools idxstats gives you a quick look at quantitative alignment results.