Overview
Before you start the alignment and analysis processes, it can be useful to perform some initial quality checks on your raw data. If you don't do this (or even if you do), you may notice later that something looks fishy in the the output: for example, many of your reads are not mapping or the ends of many of your reads do not align. Both can give you clues about whether you need to process the reads to improve the quality of data that you are putting into your analysis.
Here we will assume you have data from GSAF's Illumina HiSeq sequencer.
Learning Objectives
This tutorial covers the commands necessary to use several common programs for evaluating read files in FASTQ format and for processing them (if necessary).
- Diagnose common issues in FASTQ read files that will negatively impact analysis.
- Trim adaptor sequences and low quality regions from the ends of reads to improve analysis.
Table of Contents
When following along here, please start an idev session for running any example commands:
idev -m 60 -q development
Illumina sequence data format (FASTQ)
GSAF gives you paired end sequencing data in two matching FASTQ format files, containing reads for each end sequenced: for example, Sample_ABC_L005_R1.cat.fastq
and Sample_ABC_L005_R2.cat.fastq
. Each read end sequenced is representd by a 4-line entry in the FASTQ file.
A 4-line FASTQ file entry looks like this:
@HWI-ST1097:104:D13TNACXX:4:1101:1715:2142 1:N:0:CGATGT GCGTTGGTGGCATAGTGGTGAGCATAGCTGCCTTCCAAGCAGTTATGGGAG + =<@BDDD=A;+2C9F<CB?;CGGA<<ACEE*1?C:D>DE=FC*0BAG?DB6
- Line 1 is the read identifier, which describes the machine, flowcell, cluster, grid coordinate, end and barcode for the read. Except for the barcode information, read identifiers will be identical for corresponding entries in the R1 and R2 fastq files.
- Line 2 is the sequence reported by the machine.
- Line 3 is always '+' from GSAF (it can optionally include a sequence description)
- Line 4 is a string of Ascii-encoded base quality scores, one character per base in the sequence. For each base, an integer quality score = -10 log(probabilty base is wrong) is calculated, then added to 33 to make a number in the ASCII printable character range.
See the Wikipedia FASTQ format page for more information.
Exercise: Examine the 2nd sequence in a FASTQ file
What is the 2nd sequence in the file $BI/gva_course/mapping/data/SRR030257_1.fastq
?
Counting sequences
If you get an error from running a program, one of the first thing to check is that the length of your FASTQ files is evenly divisible by four and — if the program expects paired reads — that the R1 and R2 files have the same number of reads. The wc
command (word count) using the -l
switch to tell it to count lines, not words, is perfect for this:
wc -l $BI/gva_course/mapping/data/SRR030257_1.fastq
Exercise: Counting FASTQ file lines
How many sequences are in the FASTQ file above?
What if your fastq file has been compressed, for example by gzip
? By using pipes to link commands, you can still count the lines, and you don't have to uncompress the file to do it!
gunzip -c $BI/web/yeast_stuff/Sample_Yeast_L005_R1.cat.fastq.gz | wc -l
Here you use gunzip -c
to write decompressed data to standard output (-c
means "to console", and leaves the original *.gz
file untouched). You then pipe that output to wc -l
to get the line count.
Exercise: Counting compressed FASTQ lines
How many sequences are in the compressed FASTQ file above?
FASTQ Evaluation Tools
The first order of business after receiving sequencing data should be to check your data quality. This often-overlooked step helps guide the manner in which you process the data, and can prevent many headaches that could require you to redo an entire analysis after they rear their ugly heads.
FastQC
FastQC is a tool that produces a quality analysis report on FASTQ files.
Useful links:
- FastQC report for a good Illumina dataset
- FastQC report for a bad Illumina dataset
- Online documentation for each FastQC report
First and foremost, the FastQC "Summary" should generally be ignored. Its "grading scale" (green - good, yellow - warning, red - failed) incorporates assumptions for a particular kind of experiment, and is not applicable to most real-world data. Instead, look through the individual reports and evaluate them according to your experiment type.
The FastQC reports I find most useful are:
- The Per base sequence quality report, which can help you decide if sequence trimming is needed before alignment.
- The Sequence Duplication Levels report, which helps you evaluate library enrichment / complexity. But note that different experiment types are expected to have vastly different duplication profiles.
- The Overrepresented Sequences report, which helps evaluate adapter contamination.
Running FastQC
FastQC is available from the TACC module system on lonestar. Interactive GUI versions are also available for Windows and Macintosh and can be downloaded from the Babraham Bioinformatics web site.
FastQC creates a sub-directory for each analyzed FASTQ file, so we should copy the file we want to look at locally first. Here's how to run FastQC using the version we installed:
# setup module load fastqc cds mkdir fastqc_test cd fastqc_test cp $BI/web/yeast_stuff/Sample_Yeast_L005_R1.cat.fastq.gz . # running the program fastqc Sample_Yeast_L005_R1.cat.fastq.gz # examine extra options fastqc -h
Exercise: FastQC results
What did FastQC create?
Looking at FastQC output
You can't run a web browser directly from your "dumb terminal" command line environment. The FastQC results have to be placed where a web browser can access them. You should copy the results back to your local machine (via scp
or a GUI secure ftp client) to open them in a web browser.
If you want to skip that step (we recommend doing it for practice!), we have put a copy of the output at this URL:
http://web.corral.tacc.utexas.edu/BioITeam/yeast_stuff/Sample_Yeast_L005_R1.cat_fastqc/fastqc_report.html
Exercise: Should we trim this data?
Based on this FastQC output, should we trim (1) adaptor sequences from the ends of the reads AND/OR (2) low quality regions from the ends of the reads?
Samstat
The samstat program can also produce a quality report for FASTQ files. (We also use it again later to report on aligned sequences in a BAM file).
This program is not available through the TACC module system but is available in our $BI/bin
directory (which is on your $PATH
because of our common profile). You should be able just to type samstat
and see some documentation.
Running samstat on FASTQ files
# setup cds mkdir samstat_test cd samstat_test cp $BI/gva_course/mapping/data/SRR030257_1.fastq . # run the program samstat SRR030257_1.fastq
This produces a file named SRR030257_1.fastq.html which you need to view in a web browser. We put a copy at this URL:
http://loving.corral.tacc.utexas.edu/bioiteam/SRR030257_1.fastq.html
FASTQ Processing Tools
Trimming low quality bases
Low quality base reads from the sequencer can cause an otherwise mappable sequence not to align. There are a number of open source tools that can trim off 3' bases and produce a FASTQ file of the trimmed reads to use as input to the alignment program.
FASTX Toolkit
The FASTX-Toolkit provides a set of command line tools for manipulating fasta and fastq files. The available modules are described on their website. They include a fast fastx_trimmer utility for trimming fastq sequences (and quality score strings) before alignment.
FASTX-Toolkit is available via the TACC module system.
module spider fastx_toolkit module load fastx_toolkit
Here's an example of how to run fastx_trimmer to trim all input sequences down to 50 bases. By default the program reads its input data from standard input and writes trimmed sequences to standard output:
gunzip -c $BI/web/yeast_stuff/Sample_Yeast_L005_R1.cat.fastq.gz | fastx_trimmer -l 50 -Q 33 > trimmed.fq
- The -l 50 option says that base 50 should be the last base (i.e., trim down to 50 bases)
- the -Q 33 option specifies how base qualities on the 4th line of each fastq entry are encoded. The FASTX toolkit is an older program, written in the time when Illumina base qualities were encoded differently. These days Illumina base qualities follow the Sanger FASTQ standard (Phred score + 33 to make an ASCII character).
Exercise: compressing the fastx_trimmer output
How would you tell fastx_trimmer to compress (gzip) its output file?
Exercise: fastx toolkit programs
What other fastx manipulation programs are part of the fastx toolkit?
Adapter trimming
Data from RNA-seq or other library prep methods that resulted in very short fragments can cause problems with moderately long (100-250 base) reads since the 3' end of sequence can extend through to the 3' adapter at a variable position and even past the end of the fragment. This 3' adapter contamination can cause the "real" insert sequence not to align because the adapter sequence does not correspond to the bases at the 3' end of the reference genome sequence.
Unlike general fixed-length trimming (e.g. trimming 100 bp sequences to 40 or 50 bp), adapter trimming removes differing numbers of 3' bases depending on where the adapter sequence is found.
The GSAF website describes the flavaors of Illumina adapter and barcode sequence in more detail https://wikis.utexas.edu/display/GSAF/Illumina+-+all+flavors
Cutadapt
The cutadapt program is an excellent tool for removing adapter contamination. The program is not available through TACC's module system but we've installed a copy in our $BI/bin directory.
The most common application of cutadapt is to remove adapter contamination from small RNA library sequence data, so that's what we'll show here. Note that this step is increasingly needed for genomic sequencing of MiSeq data with 250 base reads.
Running cutadapt on small RNA library data
When you run cutadapt you give it the adapter sequence to trim, and this is different for R1 and R2 reads.
cutadapt -m 22 -O 10 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
cutadapt -m 22 -O 10 -a TGATCGTCGGACTGTAGAACTCTGAACGTGTAGA
Notes:
- The -m 22 option says to discard any sequence that is smaller than 22 bases after trimming. This avoids problems trying to map very short, highly ambiguous sequences.
- the -O 10 option says not to trim 3' adapter sequences unless at least the first 10 bases of the adapter are ssen at the 3' end of the read. This prevents trimming short 3' sequences that just happen by chance to match the first few adapter sequence bases.
Flexbar
Flexbar provides a flexible suite of commands for demultiplexing barcoded reads and removing adapter sequences or low quality regions from the ends of reads.
flexbar -n 1 --adapters adaptors.fna --source example.fastq --target example.ar --format fastq-sanger --adapter-threshold 2 --adapter-min-overlap 6 --adapter-trim-end RIGHT_TAIL
>adaptor1 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT >adaptor2 AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG >adaptor1_RC AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT >adaptor2_RC CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
Note that flexbar only searches for the sequences given (with options to allow for a given number of mismatches) NOT the reverse complement of those sequences therefore you must provide them yourself.
Trimmomatic
Trimmomatic offers similar options to Flexbar with the potential benefit that many illumina adaptor sequences are already "built-in". It is available here.
More Example Data
See if you can figure out what's wrong with these data sets (copy them to your $SCRATCH
directory before analyzing them) and then process them to get rid of the problem(s):
Example #1: Single-end data
$BI/gva_course/read_processing_example/JJM104_TAAGGCGA-TAGATCGC_L001_R1_001.fastq.gz