2021 The Basic Alignment Workflow

2021 The Basic Alignment Workflow

Overview

After raw sequence files are generated (in FASTQ format), quality-checked, and pre-processed in some way, the next step in many NGS pipelines is mapping to a reference genome.

For individual sequences it is common to use a tool like BLAST to identify genes or species of origin. However a normal NGS dataset will have tens to hundreds of millions of sequences, which BLAST and similar tools are not designed to handle. Thus a large set of computational tools have been developed to quickly align each read to its best location (if any) in a reference.

Even though many mapping tools exist, a few individual programs have a dominant "market share" of the NGS world. In this section, we will primarily focus on two of the most versatile general-purpose ones: BWA and Bowtie2 (the latter being part of the Tuxedo suite which includes the transcriptome-aware RNA-seq aligner Tophat2 as well as other downstream quantifiaction tools).

Stage the alignment data

First connect to stampede2.tacc.utexas.edu and start an idev session. This should be second nature by now

Start an idev session
idev -p normal -m 180 -A UT-2015-05-18 -N 1 -n 68

Then stage the sample datasets and references we will use.

Get the alignment exercises files
mkdir -p $SCRATCH/core_ngs/references/fasta mkdir -p $SCRATCH/core_ngs/alignment/fastq cp $CORENGS/references/*.fa $SCRATCH/core_ngs/references/fasta/ cp $CORENGS/alignment/*fastq.gz $SCRATCH/core_ngs/alignment/fastq/ cd $SCRATCH/core_ngs/alignment/fastq

These are descriptions of the FASTQ files we copied:

File Name

Description

Sample

File Name

Description

Sample

Sample_Yeast_L005_R1.cat.fastq.gz

Paired-end Illumina, First of pair, FASTQ

Yeast ChIP-seq

Sample_Yeast_L005_R2.cat.fastq.gz

Paired-end Illumina, Second of pair, FASTQ

Yeast ChIP-seq

human_rnaseq.fastq.gz

Paired-end Illumina, First of pair only, FASTQ

Human RNA-seq

human_mirnaseq.fastq.gz

Single-end Illumina, FASTQ

Human microRNA-seq

cholera_rnaseq.fastq.gz

Single-end Illumina, FASTQ

V. cholerae RNA-seq

Reference Genomes

Before we get to alignment, we need a reference to align to. This is usually an organism's genome, but can also be any set of names sequences, such as a transcriptome or other set of genes.

Here are the four reference genomes we will be using today, with some information about them. These are not necessarily the most recent versions of these references (e.g. the newest human reference genome is hg38 and the most recent miRBase annotation is v21. (See here for information about many more genomes.)

Reference

Species

Base Length

Contig Number

Source

Download

Reference

Species

Base Length

Contig Number

Source

Download

hg19

Human

3.1 Gbp

25 (really 93)

UCSC

UCSC GoldenPath

sacCer3

Yeast

12.2 Mbp

17

UCSC

UCSC GoldenPath

mirbase v20

Human subset

160 Kbp

1908

miRBase

miRBase Downloads

vibCho (O395)

Vibrio cholerae

~4 Mbp

2

GenBank

GenBank Downloads

Searching genomes is computationally hard work and takes a long time if done on linear genomic sequence. So aligners require that references first be indexed to accelerate lookup. The aligners we are using each require a different index, but use the same method (the Burrows-Wheeler Transform) to get the job done.

Building a reference index involves taking a FASTA file as input, with each contig (contiguous string of bases, e.g. a chromosome) as a separate FASTA entry, and producing an aligner-specific set of files as output. Those output index files are then used to perform the sequence alignment, and alignments are reported using coordinates referencing names and offset positions based on the original FASTA file contig entries.

We can quickly index the references for the yeast genome, the human miRNAs, and the V. cholerae genome, because they are all small, so we'll build each index from the appropriate FASTA files right before we use them. 

hg19 is way too big for us to index here so we will use an existing set of BWA hg19 index files located at:

BWA hg19 index location
/work2/projects/BioITeam/ref_genome/bwa/bwtsw/hg19

The BioITeam maintains a set of reference indexes for many common organisms and aligners. They can be found in aligner-specific sub-directories of the /work2/projects/BioITeam/ref_genome area. E.g.:

/work2/projects/BioITeam/ref_genome/ bowtie2/ bwa/ hisat2/ kallisto/ star/ tophat/

Exploring FASTA with grep

It is often useful to know what chromosomes/contigs are in a FASTA file before you start an alignment so that you're familiar with the contig naming convention – and to verify that it's the one you expect.  For example, chromosome 1 is specified differently in different references and organisms: chr1 (USCS human), chrI (UCSC yeast), or just 1 (Ensembl human GRCh37).

FASTA file consists of a number of contig name entries, each one starting with a right carat ( > ) character, followed by many lines of base characters. E.g.:

>chrI CCACACCACACCCACACACCCACACACCACACCACACACCACACCACACC CACACACACACATCCTAACACTACCCTAACACAGCCCTAATCTAACCCTG GCCAACCTGTCTCTCAACTTACCCTCCATTACCCTGCCTCCACTCGTTAC CCTGTCCCATTCAACCATACCACTCCGAACCACCATCCATCCCTCTACTT

How do we dig out just the lines that have the contig names and ignore all the sequences? Well, the contig name lines all follow the pattern above, and since the > character is not a valid base, it will never appear on a sequence line.

We've discovered a pattern (also known as a regular expression) to use in searching, and the command line tool that does regular expression matching is grep (general regular expression parser). Read more about grep here: Advanced commands: grep.

Regular expressions are so powerful that nearly every modern computer language includes a "regex" module of some sort. There are many online tutorials for regular expressions, and several slightly different "flavors" of them. But the most common is the Perl style (http://perldoc.perl.org/perlretut.html), which was one of the fist and still the most powerful (there's a reason Perl was used extensively when assembling the human genome). We're only going to use the most simple of regular expressions here, but learning more about them will pay handsome dividends for you in the future.

Here's how to execute grep to list contig names in a FASTA file.

grep to match contig names in a FASTA file
cd $SCRATCH/core_ngs/references/fasta grep -P '^>' sacCer3.fa | more

Notes:

  • The -P option tells grep to Perl-style regular expression patterns. 

    • This makes including special characters like Tab ( \t ), Carriage Return ( \r ) or Linefeed ( \n ) much easier that the default POSIX paterns.

    • While it is not required here, it generally doesn't hurt to include this option.

  • '^>' is the regular expression describing the pattern we're looking for (described below)

  • sacCer3.fa is the file to search. 

    • lines with text that match our pattern will be written to standard output

    • non matching lines will be omitted

  • We pipe to more just in case there are a lot of contig names.

Now down to the nuts and bolts of the pattern: '^>'

First, the single quotes around the pattern – this tells the bash shell to pass the exact string contents to grep.

As part of its friendly command line parsing and evaluation, the shell will often look for special characters on the command line that mean something to it (for example, the $ in front of an environment variable name, like in $SCRATCH). Well, regular expressions treat the $ specially too – but in a completely different way! Those single quotes tell the shell "don't look inside here for special characters – treat this as a literal string and pass it to the program". The shell will obey, will strip the single quotes off the string, and will pass the actual pattern, ^>, to the grep program. (Note that the shell does look inside double quotes ( " ) for certain special signals, such as looking for environment variable names to evaluate. Read more about Quoting in the shell.)

So what does ^> mean to grep? We know that contig name lines always start with a > character, so > is a literal for grep to use in its pattern match.

We might be able to get away with just using this literal alone as our regex, specifying '>' as the command line argument. But for grep, the more specific the pattern, the better. So we constrain where the > can appear on the line. The special carat ( ^ )  metacharacter represents "beginning of line". So ^> means "beginning of a line followed by a > character".

Exercise: How many contigs are there in the sacCer3 reference?

Get the alignment exercises files
mkdir -p $SCRATCH/core_ngs/references/fasta cp $CORENGS/references/*.fa $SCRATCH/core_ngs/references/fasta/
cd $SCRATCH/core_ngs/references/fasta grep -P '^>' sacCer3.fa | wc -l

Or use grep's -c option that says "just count the line matches"

grep -P -c '^>' sacCer3.fa

 

There are 17 contigs.

Aligner overview

There are many aligners available, but we will concentrate on two of the most popular general-purpose ones: bwa and bowtie2. The table below outlines the available protocols for them.

alignment type

aligner options

pro's

con's

alignment type

aligner options

pro's

con's

global with bwa 

SE:

  • bwa aln <R1>

  • bwa samse

PE:

  • bwa aln <R1>

  • bwa aln <R2>

  • bwa sampe

  • simple to use (take default options)

  • good for basic global alignment

  • multiple steps needed

global with bowtie2

bowtie2 --global

  • extremely configurable

  • can be used for RNAseq alignment (after adapter trimming) because of its many options

  • complex (many options)

local with bwa 

bwa mem

  • simple to use (take default options)

  • very fast

  • no adapter trimming needed

  • good for simple RNAseq analysis

    • the secondary alignments it reports provide splice junction information

  • always produces alignments with secondary reads

    • must be filtered if not desired

local with bowtie2

bowtie2 --local

  • extremely configurable

  • no adapter trimming needed

  • good for small RNA alignment because of its many options

  • complex – many options

 

Exercise #1: BWA global alignment – Yeast ChIP-seq

Overview ChIP-seq alignment workflow with BWA

We will perform a global alignment of the paired-end Yeast ChIP-seq sequences using bwa. This workflow has the following steps:

  1. Trim the FASTQ sequences down to 50 with fastx_clipper

    • this removes most of any 5' adapter contamination without the fuss of specific adapter trimming w/cutadapt

  2. Prepare the sacCer3 reference index for bwa using bwa index

    • this is done once, and re-used for later alignments

  3. Perform a global bwa alignment on the R1 reads (bwa aln) producing a BWA-specific binary .sai intermediate file

  4. Perform a global bwa alignment on the R2 reads (bwa aln) producing a BWA-specific binary .sai intermediate file

  5. Perform pairing of the separately aligned reads and report the alignments in SAM format using bwa sampe

  6. Convert the SAM file to a BAM file (samtools view)

  7. Sort the BAM file by genomic location (samtools sort)

  8. Index the BAM file (samtools index)

  9. Gather simple alignment statistics (samtools flagstat and samtools idxstat)

We're going to skip the trimming step for now and see how it goes. We'll perform steps 2 - 5 now and leave samtools for a later exercise since steps 6 - 10 are common to nearly all post-alignment workflows.

Introducing BWA

Like other tools you've worked with so far, you first need to load bwa. Do that now, and then enter bwa with no arguments to view the top-level help page (many NGS tools will provide some help when called with no arguments). Note that bwa is available both from the standard TACC module system and as BioContainers. module.

Start an idev session
idev -p normal -m 120 -A UT-2015-05-18 -N 1 -n 68
module load biocontainers # takes a while module load bwa bwa
BWA suite usage
Program: bwa (alignment via Burrows-Wheeler transformation) Version: 0.7.17-r1188 Contact: Heng Li <lh3@sanger.ac.uk> Usage: bwa <command> [options] Command: index index sequences in the FASTA format mem BWA-MEM algorithm fastmap identify super-maximal exact matches pemerge merge overlapping paired ends (EXPERIMENTAL) aln gapped/ungapped alignment samse generate alignment (single ended) sampe generate alignment (paired ended) bwasw BWA-SW for long queries shm manage indices in shared memory fa2pac convert FASTA to PAC format pac2bwt generate BWT from PAC pac2bwtgen alternative algorithm for generating BWT bwtupdate update .bwt to the new format bwt2sa generate SA from BWT and Occ Note: To use BWA, you need to first index the genome with `bwa index'. There are three alignment algorithms in BWA: `mem', `bwasw', and `aln/samse/sampe'. If you are not sure which to use, try `bwa mem' first. Please `man ./bwa.1' for the manual.

As you can see, bwa include many sub-commands that perform the tasks we are interested in.

Building the BWA sacCer3 index

We will index the genome with the bwa index command. Type bwa index with no arguments to see usage for this sub-command.

bwa index usage
Usage: bwa index [options] <in.fasta> Options: -a STR BWT construction algorithm: bwtsw, is or rb2 [auto] -p STR prefix of the index [same as fasta name] -b INT block size for the bwtsw algorithm (effective with -a bwtsw) [10000000] -6 index files named as <in.fasta>.64.* instead of <in.fasta>.* Warning: `-a bwtsw' does not work for short genomes, while `-a is' and `-a div' do not work not for long genomes.

Based on the usage description, we only need to specify two things:

  • The name of the FASTA file  

  • Whether to use the bwtsw or is algorithm for indexing

Since sacCer3 is relative large (~12 Mbp) we will specify bwtsw as the indexing option (as indicated by the "Warning" message), and the name of the FASTA file is sacCer3.fa.

The output of this command is a group of files that are all required together as the index. So, within our references directory, we will create another directory called references/bwa/sacCer3 and build the index there. To remind ourselves which FASTA was used to build the index, we create a symbolic link to our references/fasta/sacCer3.fa file (note the use of the ../.. relative path syntax).

Get the alignment exercises files
mkdir -p $SCRATCH/core_ngs/alignment/fastq mkdir -p $SCRATCH/core_ngs/references/fasta cp $CORENGS/alignment/*fastq.gz $SCRATCH/core_ngs/alignment/fastq/ cp $CORENGS/references/*.fa $SCRATCH/core_ngs/references/fasta/
Prepare BWA reference directory for sacCer3
mkdir -p $SCRATCH/core_ngs/references/bwa/sacCer3 cd $SCRATCH/core_ngs/references/bwa/sacCer3 ln -s ../../fasta/sacCer3.fa ls -l

Now execute the bwa index command.

Build BWA index for sacCer3
bwa index -a bwtsw sacCer3.fa

Since the yeast genome is not large when compared to human, this should not take long to execute (otherwise we would do it as a batch job). When it is complete you should see a set of index files like this:

BWA index files for sacCer3
sacCer3.fa sacCer3.fa.amb sacCer3.fa.ann sacCer3.fa.bwt sacCer3.fa.pac sacCer3.fa.sa

Performing the bwa alignment

Now, we're ready to execute the actual alignment, with the goal of initially producing a SAM file from the input FASTQ files and reference. First prepare a directory for this exercise and link the sacCer3 reference directories there (this will make our commands more readable).

# Copy the pre-built references mkdir -p $SCRATCH/core_ngs/references cp $CORENGS/references/*.fa $SCRATCH/core_ngs/references/fasta/ # Get the FASTQ to align mkdir -p $SCRATCH/core_ngs/alignment/fastq cp $CORENGS/alignment/*fastq.gz $SCRATCH/core_ngs/alignment/fastq/
Prepare to align yeast data
mkdir -p $SCRATCH/core_ngs/alignment/yeast_bwa cd $SCRATCH/core_ngs/alignment/yeast_bwa ln -s -f ../fastq ln -s -f ../../references/bwa/sacCer3

As our workflow indicated, we first use bwa aln on the R1 and R2 FASTQs, producing a BWA-specific .sai intermediate binary files.

What does bwa aln needs in the way of arguments?

bwa aln

There are lots of options, but here is a summary of the most important ones.

Option

Effect

Option

Effect

-l

Specifies the length of the seed (default = 32)

-k

Specifies the number of mismatches allowable in the seed of each alignment (default = 2)

-n

Specifies the number of mismatches (or fraction of bases in a given alignment that can be mismatches) in the entire alignment (including the seed) (default = 0.04)

-t

Specifies the number of threads

Other options control the details of how much a mismatch or gap is penalized, limits on the number of acceptable hits per read, and so on. Much more information can be found on the BWA manual page.

For a basic alignment like this, we can just go with the default alignment parameters.

Note that bwa writes its (binary) output to standard output by default, so we need to redirect that to a .sai file.

For simplicity, we will just execute these commands directly, one at a time. Each command should only take few minutes and you will see bwa's progress messages in your terminal.

bwa aln commands for yeast R1 and R2
# If not already loaded: module load biocontainers module load bwa cd $SCRATCH/core_ngs/alignment/yeast_bwa bwa aln sacCer3/sacCer3.fa fastq/Sample_Yeast_L005_R1.cat.fastq.gz > yeast_R1.sai bwa aln sacCer3/sacCer3.fa fastq/Sample_Yeast_L005_R2.cat.fastq.gz > yeast_R2.sai

When all is done you should have two .sai files: yeast_R1.sai and yeast_R2.sai.

Make sure your output files are not empty

Double check that output was written by doing ls -lh and making sure the file sizes listed are not 0.

Exercise: How long did it take to align the R2 file?

The last few lines of bwa's execution output should look something like this:

[bwa_aln] 17bp reads: max_diff = 2 [bwa_aln] 38bp reads: max_diff = 3 [bwa_aln] 64bp reads: max_diff = 4 [bwa_aln] 93bp reads: max_diff = 5 [bwa_aln] 124bp reads: max_diff = 6 [bwa_aln] 157bp reads: max_diff = 7 [bwa_aln] 190bp reads: max_diff = 8 [bwa_aln] 225bp reads: max_diff = 9 [bwa_aln_core] calculate SA coordinate... 50.76 sec [bwa_aln_core] write to the disk... 0.07 sec [bwa_aln_core] 262144 sequences have been processed. [bwa_aln_core] calculate SA coordinate... 50.35 sec [bwa_aln_core] write to the disk... 0.07 sec [bwa_aln_core] 524288 sequences have been processed. [bwa_aln_core] calculate SA coordinate... 13.64 sec [bwa_aln_core] write to the disk... 0.01 sec [bwa_aln_core] 592180 sequences have been processed. [main] Version: 0.7.17-r1188 [main] CMD: /usr/local/bin/bwa aln sacCer3/sacCer3.fa fastq/Sample_Yeast_L005_R1.cat.fastq.gz [main] Real time: 122.936 sec; CPU: 123.597 sec

So the R2 alignment took ~123 seconds (~2 minutes).

Since you have your own private compute node, you can use all its resources. It has 68 cores, so re-run the R2 alignment asking for 60 execution threads.

bwa aln -t 60 sacCer3/sacCer3.fa fastq/Sample_Yeast_L005_R2.cat.fastq.gz > yeast_R2.sai

Exercise: How much of a speedup did you seen when aligning the R2 file with 20 threads?

The last few lines of bwa's execution output should look something like this:

[bwa_aln] 17bp reads: max_diff = 2 [bwa_aln] 38bp reads: max_diff = 3 [bwa_aln] 64bp reads: max_diff = 4 [bwa_aln] 93bp reads: max_diff = 5 [bwa_aln] 124bp reads: max_diff = 6 [bwa_aln] 157bp reads: max_diff = 7 [bwa_aln] 190bp reads: max_diff = 8 [bwa_aln] 225bp reads: max_diff = 9 [bwa_aln_core] calculate SA coordinate... 266.70 sec [bwa_aln_core] write to the disk... 0.04 sec [bwa_aln_core] 262144 sequences have been processed. [bwa_aln_core] calculate SA coordinate... 268.94 sec [bwa_aln_core] write to the disk... 0.03 sec [bwa_aln_core] 524288 sequences have been processed. [bwa_aln_core] calculate SA coordinate... 72.26 sec [bwa_aln_core] write to the disk... 0.01 sec [bwa_aln_core] 592180 sequences have been processed. [main] Version: 0.7.17-r1188 [main] CMD: /usr/local/bin/bwa aln -t 60 sacCer3/sacCer3.fa fastq/Sample_Yeast_L005_R2.cat.fastq.gz [main] Real time: 19.872 sec; CPU: 617.095 sec

So the R2 alignment took only ~20 seconds (real time), or 6+ times as fast as with only one processing thread.

Note, though, that the CPU time with 60 threads was greater (617 sec) than with only 1 thread (124 sec). That's because of the thread management overhead when using multiple threads.

Next we use the bwa sampe command to pair the reads and output SAM format data. Just type that command in with no arguments to see its usage.

For this command you provide the same reference index prefix as for bwa aln, along with the two .sai files and the two original FASTQ files. Also, bwa writes its output to standard output, so redirect that to a .sam file.