Genome Assembly (velvet) -- GVA2017
Overview
Velvet is a De Bruijn graph assembler works fairly rapidly on short (microbial) genomes. In this tutorial we will use velvet to assemble an E. coli genome from simulated Illumina reads. Genome assembly is quite difficult (though as Oxford Nanopore comes online it will likely get much easier and involve new tools). Genome assembly should only be used when you can not find a reference genome that is close to your own, if you are engaged in metagenomic projects where you don't know what organisms may be present, and in situations where you believe you may have novel sequence insertions into a genome of interest (Note that in this case however you would actually want to grab reads that do not map to your reference genome (and their pair in the case of paired end and mate-pair sequencing) rather than performing these functions on the fastq files you get from the gsaf.
Learning Objectives
Run velvet to perform de novo assembly on fragment, paired-end, and mate-paired data.
Use contig_stats.pl to display assembly statistics.
Find proteins of interest in an assembly using Blast.
Table of Contents
Data
Tutorial assumes that you are on an idev node. If you are not sure please ask for help.
Move to scratch, copy the raw data, and change into this directory for the tutorial
cds
mkdir BDIB_velvet_tutorial
cp $BI/ngs_course/velvet/data/*/* BDIB_velvet_tutorial
cd BDIB_velvet_tutorial
Now we have a bunch of Illumina reads. These are simulated reads. If you'd ever like to simulate some on your own, you might try using Mason.
Files in the tutorial directory
paired_end_2x100_ins_1500_c_20.fastq paired_end_2x100_ins_400_c_20.fastq single_end_100_c_50.fastq
paired_end_2x100_ins_3000_c_20.fastq paired_end_2x100_ins_400_c_25.fastq
paired_end_2x100_ins_3000_c_25.fastq paired_end_2x100_ins_400_c_50.fastq
There are 4 sets of simulated reads:
| Set 1 | Set 2 | Set 3 | Set 4 |
|---|---|---|---|---|
Read Size | 100 | 100 | 100 | 100 |
Paired/Single Reads | Single | Paired | Paired | Paired |
Gap Sizes | NA | 400 | 400, 3000 | 400, 3000, 1500 |
Coverage | 50 | 50 | 25 for each subset | 20 for each subset |
Number of Subsets | 1 | 1 | 2 | 3 |
Note that these fastq files are "interleaved", with each read pair together one-after-the-other in the file. The #/1 and #/2 in the read names indicate the pairs.
Interleaved fastq
tacc:~$ head paired_end_2x100_ins_1500_c_20.fastq
@READ-1/1
TTTCACCGTTGACCAGCACCCAGTTCAGCGCCGCGCGACCACGATATTTTGGTAACAGCGAACCATGCAGATTAAATGCACCTGCGGGAGCGAGCTGCAA
+
*@A+<at:var at:name="55G" />T@@I&+@A+@@<at:var at:name="II" />G@+++A++GG++@++I@+@+G&/+I+GD+II@++G@@I?<at:var at:name="I" />@<at:var at:name="IIGGI" /><at:var at:name="A4" />6@A,+AT=<at:var at:name="G" />+@AA+GAG++@
@READ-1/2
TTAACACCGGGCTATAAGTACAATCTGACCGATATTAACGCCGCGATTGCCCTGACACAGTTAGTCAAATTAGAGCACCTCAACACCCGTCGGCGCGAAA
+
I@@H+A+@G+&+@AG+I>G+I@+CAIA++$+T<at:var at:name="GG" />@+++1+<at:var at:name="GI" />+ICI+A+@<at:var at:name="I" />++A+@@A.@<G@@+)GCGC%I@IIAA++++G+A;@+++@@@@6
Often your read pairs will be "separate" with the corresponding paired reads at the same index in two different files (each with exactly the same number of reads).
Velvet Assembly
Now let's use Velvet to assemble the reads.
First, you will need to load the velvet module.
Using velvet consists of a sequence of two commands:
velveth- analyzes kmers in the reads in preparation for assemblyvelvetg- constructs the assembly and filters contigs from the graph
Look at the help for each program.
The <hash_length> parameter of velveth is the kmer value that is key to the assembly process. Choosing it controls the tradeoff between sensitivity (lower hash_length, more reads included, longer contigs) and specificity (higher hash length, less chance of misassembly, more reads ignored, shorter contigs)). There is more discussion about choosing an appropriate kmer value in the Velvet manual and in this blog post.
Velvet has an option of specifying the insertion size of a paired read file (-ins_length). If no size is given, Velvet will guess the insertion size. We'll just have Velvet guess the size.
Velvet also has an option to specify the expected coverage of the genome, which helps it choose how to resolve repeated sequences (-exp_cov). We set this parameter to estimate this from the data. A common problem with using Velvet is that you have many very short contigs and the last line of output tells you that it used 0 of your reads. This is caused by not setting this parameter. The default is NOT auto.
The following commands will each take some time to run, while they run, read ahead to learn more about what you will be seeing:
Run 1 line at a time (4 lines total) on an idev node. If you copy and paste, be sure that you get both the velveth command and the velvetg command after the && symbol on the same line
velveth single_out 61 -fastq single_end_100_c_50.fastq && velvetg single_out -exp_cov auto -amos_file yes
velveth pairedc20_out 61 -fastq -shortPaired paired_end_2x100_ins_3000_c_20.fastq paired_end_2x100_ins_1500_c_20.fastq paired_end_2x100_ins_400_c_20.fastq && velvetg pairedc20_out -exp_cov auto -amos_file yes
velveth pairedc25_out 61 -fastq -shortPaired paired_end_2x100_ins_3000_c_25.fastq paired_end_2x100_ins_400_c_25.fastq && velvetg pairedc25_out -exp_cov auto -amos_file yes
velveth pairedc50_out 61 -fastq -shortPaired paired_end_2x100_ins_400_c_50.fastq && velvetg pairedc50_out -exp_cov auto -amos_file yes
A warning on memory usage
Velvet and other assemblers usually take large amounts of RAM to complete. Running these 4 commands on a single node at the same time will likely use more RAM than is available on a single node so it's necessary to run them sequentially. This should also underscore to you that you should not run this on the head node. If you are assembling large genomes or have high coverage depth data in the future, you will probably need to submit your jobs to the "largemem" queue rather than the standard que.
What does the && symbol mean?
As we discussed in our piping tutorial, things separated by a ';' mark will execute 1 after the other. In the case of &&, the second command will only execute if the first command finishes correctly (exit status zero to get technical). This can be useful to consider when building a pipeline to limit progression from 1 program to another when something has failed, BUT only if you understand exit states of each program.
Velvet Output
Explore each output directory that was created by Velvet.
Checking the tail of the Log files in each of the output folders, we see lines like the following:
With better read pairs that link more distant locations in the genome, there are fewer contigs, and contigs are are longer, giving us a more complete picture of linkage across the genome.
The complete E. coli genome is about 4.6 Mb. Why weren't we able to assemble it, even with this "perfect" data?
More assembly statistics: contig_stats.pl
The output file stats.txt contains information about every contig in the assembly, but it isn't sorted and can be a bit overwhelming.
You can generate some summary stats and graphs about each assembly using the contig_stats.pl script in the $BI/bin. You probably want to change into the directory of results for a specific assembly before running this command, since it generates several output files in the current working directory. You will need to copy the PNG files back to your computer to view it using scp.
Transfer back several of the different outputs into their own direcotry and being comparing them to determine which library and set of parameters seemed to work best.
What do I do now?
Many choices:
Get a better assembly: maybe add a different library size, or go into a detailed genome completion project (commonly called "finishing") using a sequence assembly editor like
consedorgap4orAMOS. (Be careful though, the amount of data in NGS data sets can be very difficult for these programs to deal with, since many were designed for Sanger sequencing reads.) You may have a lot of PCR products to make to close gaps and/or to order and orient scaffolds.consedin particular makes this pretty easy, but it may still consume a lot more time and money than the initial shotgun assembly. You can identify some misassemblies by mapping the original reads to the assembly and then viewing them in IGV to look for discordant mate pairs, for example.Look for things: If you're just after a few homologs, an operon, etc. you're probably done. Most assemblers will be able to take 2x100 data and give you full gene sequences since these are non-repetitive and so assemble well, and obviously 2x600 miSEQ runs will do even better. You can turn the contigs.fa into a blast database (
formatdbormakeblastdbdepending on which version of blast you have) and start blasting away.